human geckov2 crispr knockout pooled libraries Search Results


96
Addgene inc human geckov2 crispr knockout pooled library
Human Geckov2 Crispr Knockout Pooled Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+geckov2+crispr+knockout+pooled+libraries/pmc08610583-190-1-13?v=Addgene+inc
Average 96 stars, based on 1 article reviews
human geckov2 crispr knockout pooled library - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

93
Addgene inc mouse gecko v2 library
Mouse Gecko V2 Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+geckov2+crispr+knockout+pooled+libraries/pmc05526071-1140-82-89?v=Addgene+inc
Average 93 stars, based on 1 article reviews
mouse gecko v2 library - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc human crispr knockout pooled library

Human Crispr Knockout Pooled Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+geckov2+crispr+knockout+pooled+libraries/pmc06917043-46-0-8?v=Addgene+inc
Average 93 stars, based on 1 article reviews
human crispr knockout pooled library - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

95
Addgene inc genome wide crispr knockout gecko v2 library
Integrated analyses of genome-Wide <t>CRISPR/Cas9</t> screen and transcriptome sequencing. (A) Workflow of genome wide CRISPR/Cas9 knockout screening with PTX treatment. (B) Single guide RNA (sgRNA) read variations on day 14 after PTX treatment, compared to DMSO treatment. (C) Genes known to sensitize cellular response to PTX treatment. (D) Well-known resistant genes in response to PTX treatment. (E) Diagram illustrates construction of paclitaxel-resistant MDA-MB-231 cells. The cells were treated with 1 µM paclitaxel for 24 h, then changed to normal culture medium for 2 weeks. This procedure was repeated 12 times. (F) Bubble chart exhibiting significant differentially expressed genes with a log 2 -fold change (FC) ≤ -1 or ≥ 1. Bubble size represents the value of log 2 TPM in 231-PTX cells. (G) Triangle chart confirmed previously-reported genes playing a critical role in paclitaxel resistance in cancer. The size of the triangle represents the value of log 2 TPM in 231-PTX cells. (H) Distribution of the top 20 GSEA drug resistant-associated pathways: Taxol agent-related pathways constitute 25% of the total pathways. (I) One of the GSEA enrichment analyses among the top 20 Taxol-related pathways.
Genome Wide Crispr Knockout Gecko V2 Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+geckov2+crispr+knockout+pooled+libraries/pmc07532680-35-1-10?v=Addgene+inc
Average 95 stars, based on 1 article reviews
genome wide crispr knockout gecko v2 library - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

90
GenScript corporation human crispr knockout pooled library (gecko v2) lentivirus
Integrated analyses of genome-Wide <t>CRISPR/Cas9</t> screen and transcriptome sequencing. (A) Workflow of genome wide CRISPR/Cas9 knockout screening with PTX treatment. (B) Single guide RNA (sgRNA) read variations on day 14 after PTX treatment, compared to DMSO treatment. (C) Genes known to sensitize cellular response to PTX treatment. (D) Well-known resistant genes in response to PTX treatment. (E) Diagram illustrates construction of paclitaxel-resistant MDA-MB-231 cells. The cells were treated with 1 µM paclitaxel for 24 h, then changed to normal culture medium for 2 weeks. This procedure was repeated 12 times. (F) Bubble chart exhibiting significant differentially expressed genes with a log 2 -fold change (FC) ≤ -1 or ≥ 1. Bubble size represents the value of log 2 TPM in 231-PTX cells. (G) Triangle chart confirmed previously-reported genes playing a critical role in paclitaxel resistance in cancer. The size of the triangle represents the value of log 2 TPM in 231-PTX cells. (H) Distribution of the top 20 GSEA drug resistant-associated pathways: Taxol agent-related pathways constitute 25% of the total pathways. (I) One of the GSEA enrichment analyses among the top 20 Taxol-related pathways.
Human Crispr Knockout Pooled Library (Gecko V2) Lentivirus, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+geckov2+crispr+knockout+pooled+libraries/pmc09892530-158-1-9?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
human crispr knockout pooled library (gecko v2) lentivirus - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

94
Addgene inc mouse crispr knockout pooled library
Integrated analyses of genome-Wide <t>CRISPR/Cas9</t> screen and transcriptome sequencing. (A) Workflow of genome wide CRISPR/Cas9 knockout screening with PTX treatment. (B) Single guide RNA (sgRNA) read variations on day 14 after PTX treatment, compared to DMSO treatment. (C) Genes known to sensitize cellular response to PTX treatment. (D) Well-known resistant genes in response to PTX treatment. (E) Diagram illustrates construction of paclitaxel-resistant MDA-MB-231 cells. The cells were treated with 1 µM paclitaxel for 24 h, then changed to normal culture medium for 2 weeks. This procedure was repeated 12 times. (F) Bubble chart exhibiting significant differentially expressed genes with a log 2 -fold change (FC) ≤ -1 or ≥ 1. Bubble size represents the value of log 2 TPM in 231-PTX cells. (G) Triangle chart confirmed previously-reported genes playing a critical role in paclitaxel resistance in cancer. The size of the triangle represents the value of log 2 TPM in 231-PTX cells. (H) Distribution of the top 20 GSEA drug resistant-associated pathways: Taxol agent-related pathways constitute 25% of the total pathways. (I) One of the GSEA enrichment analyses among the top 20 Taxol-related pathways.
Mouse Crispr Knockout Pooled Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+geckov2+crispr+knockout+pooled+libraries/pmc09946360-216-6-13?v=Addgene+inc
Average 94 stars, based on 1 article reviews
mouse crispr knockout pooled library - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

96
Addgene inc two vector
Integrated analyses of genome-Wide <t>CRISPR/Cas9</t> screen and transcriptome sequencing. (A) Workflow of genome wide CRISPR/Cas9 knockout screening with PTX treatment. (B) Single guide RNA (sgRNA) read variations on day 14 after PTX treatment, compared to DMSO treatment. (C) Genes known to sensitize cellular response to PTX treatment. (D) Well-known resistant genes in response to PTX treatment. (E) Diagram illustrates construction of paclitaxel-resistant MDA-MB-231 cells. The cells were treated with 1 µM paclitaxel for 24 h, then changed to normal culture medium for 2 weeks. This procedure was repeated 12 times. (F) Bubble chart exhibiting significant differentially expressed genes with a log 2 -fold change (FC) ≤ -1 or ≥ 1. Bubble size represents the value of log 2 TPM in 231-PTX cells. (G) Triangle chart confirmed previously-reported genes playing a critical role in paclitaxel resistance in cancer. The size of the triangle represents the value of log 2 TPM in 231-PTX cells. (H) Distribution of the top 20 GSEA drug resistant-associated pathways: Taxol agent-related pathways constitute 25% of the total pathways. (I) One of the GSEA enrichment analyses among the top 20 Taxol-related pathways.
Two Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+geckov2+crispr+knockout+pooled+libraries/pmc11609810-36-12-22?v=Addgene+inc
Average 96 stars, based on 1 article reviews
two vector - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

93
Addgene inc plasmid human geckov2
Integrated analyses of genome-Wide <t>CRISPR/Cas9</t> screen and transcriptome sequencing. (A) Workflow of genome wide CRISPR/Cas9 knockout screening with PTX treatment. (B) Single guide RNA (sgRNA) read variations on day 14 after PTX treatment, compared to DMSO treatment. (C) Genes known to sensitize cellular response to PTX treatment. (D) Well-known resistant genes in response to PTX treatment. (E) Diagram illustrates construction of paclitaxel-resistant MDA-MB-231 cells. The cells were treated with 1 µM paclitaxel for 24 h, then changed to normal culture medium for 2 weeks. This procedure was repeated 12 times. (F) Bubble chart exhibiting significant differentially expressed genes with a log 2 -fold change (FC) ≤ -1 or ≥ 1. Bubble size represents the value of log 2 TPM in 231-PTX cells. (G) Triangle chart confirmed previously-reported genes playing a critical role in paclitaxel resistance in cancer. The size of the triangle represents the value of log 2 TPM in 231-PTX cells. (H) Distribution of the top 20 GSEA drug resistant-associated pathways: Taxol agent-related pathways constitute 25% of the total pathways. (I) One of the GSEA enrichment analyses among the top 20 Taxol-related pathways.
Plasmid Human Geckov2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+geckov2+crispr+knockout+pooled+libraries/patel_shashankkumar_jitendra__2017__a_genome_scale_crispr_screen_to_identify_essential_genes_for_the_effector_function_of-477-22-32?v=Addgene+inc
Average 93 stars, based on 1 article reviews
plasmid human geckov2 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

85
Addgene inc human crispr knockout pooled library a
a , Western blots of HEK293T cells and of Cx43 and Cx43/Cx45 knockout cell lines generated with <t>CRISPR-Cas9.</t> Vinculin was used as a loading control. b , Representative normalized fluorescence traces of two visually connected Cx43/Cx45 KO cells stably expressing rEstus2s. c , Linear correlation of the time traces from b with superimposed linear fit (bold line). d , r values from linear correlations of rEstus2s for Cx43 KO, Cx43/Cx45 KO, and Cx43/Cx45 KO with stable overexpression of Cx43. Black rhombs are means. e, f , Superimposed normalized fluorescence traces of 50 Cx43 KO cells each with rEstus2s, or Cx43/Cx45 KO cells with rEstus2s either alone or with additional overexpression of Cx43, ANO1, or K Ca 3.1. Cells were either individual (e) or in a confluent layer (f). g , Peak-to-peak excursions of relative rEstus2s fluorescence in individual and confluent cells. The number of analyzed cells is indicated in parentheses.
Human Crispr Knockout Pooled Library A, supplied by Addgene inc, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+geckov2+crispr+knockout+pooled+libraries/bio_rxiv__64898__2026__02__10__701308-210-7-19?v=Addgene+inc
Average 85 stars, based on 1 article reviews
human crispr knockout pooled library a - by Bioz Stars, 2026-08
85/100 stars
  Buy from Supplier

93
Addgene inc mouse gecko v2 crispr knockout pooled library
a , Western blots of HEK293T cells and of Cx43 and Cx43/Cx45 knockout cell lines generated with <t>CRISPR-Cas9.</t> Vinculin was used as a loading control. b , Representative normalized fluorescence traces of two visually connected Cx43/Cx45 KO cells stably expressing rEstus2s. c , Linear correlation of the time traces from b with superimposed linear fit (bold line). d , r values from linear correlations of rEstus2s for Cx43 KO, Cx43/Cx45 KO, and Cx43/Cx45 KO with stable overexpression of Cx43. Black rhombs are means. e, f , Superimposed normalized fluorescence traces of 50 Cx43 KO cells each with rEstus2s, or Cx43/Cx45 KO cells with rEstus2s either alone or with additional overexpression of Cx43, ANO1, or K Ca 3.1. Cells were either individual (e) or in a confluent layer (f). g , Peak-to-peak excursions of relative rEstus2s fluorescence in individual and confluent cells. The number of analyzed cells is indicated in parentheses.
Mouse Gecko V2 Crispr Knockout Pooled Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+geckov2+crispr+knockout+pooled+libraries/pmc07769003-28-8-15?v=Addgene+inc
Average 93 stars, based on 1 article reviews
mouse gecko v2 crispr knockout pooled library - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

Image Search Results


Journal: Cell reports

Article Title: Suppression of Ribosomal Pausing by eIF5A Is Necessary to Maintain the Fidelity of Start Codon Selection

doi: 10.1016/j.celrep.2019.10.129

Figure Lengend Snippet:

Article Snippet: Human CRISPR Knockout Pooled Library (GeCKO v2) , Addgene (Feng Zhang) , Pooled Library #1000000048, #1000000049 ( ) .

Techniques: Recombinant, Transfection, Infection, Cloning, Library Quantification, SYBR Green Assay, Mutagenesis, Reporter Assay, CRISPR, Plasmid Preparation, Knock-Out, Software

Integrated analyses of genome-Wide CRISPR/Cas9 screen and transcriptome sequencing. (A) Workflow of genome wide CRISPR/Cas9 knockout screening with PTX treatment. (B) Single guide RNA (sgRNA) read variations on day 14 after PTX treatment, compared to DMSO treatment. (C) Genes known to sensitize cellular response to PTX treatment. (D) Well-known resistant genes in response to PTX treatment. (E) Diagram illustrates construction of paclitaxel-resistant MDA-MB-231 cells. The cells were treated with 1 µM paclitaxel for 24 h, then changed to normal culture medium for 2 weeks. This procedure was repeated 12 times. (F) Bubble chart exhibiting significant differentially expressed genes with a log 2 -fold change (FC) ≤ -1 or ≥ 1. Bubble size represents the value of log 2 TPM in 231-PTX cells. (G) Triangle chart confirmed previously-reported genes playing a critical role in paclitaxel resistance in cancer. The size of the triangle represents the value of log 2 TPM in 231-PTX cells. (H) Distribution of the top 20 GSEA drug resistant-associated pathways: Taxol agent-related pathways constitute 25% of the total pathways. (I) One of the GSEA enrichment analyses among the top 20 Taxol-related pathways.

Journal: Theranostics

Article Title: Truncated HDAC9 identified by integrated genome-wide screen as the key modulator for paclitaxel resistance in triple-negative breast cancer

doi: 10.7150/thno.44997

Figure Lengend Snippet: Integrated analyses of genome-Wide CRISPR/Cas9 screen and transcriptome sequencing. (A) Workflow of genome wide CRISPR/Cas9 knockout screening with PTX treatment. (B) Single guide RNA (sgRNA) read variations on day 14 after PTX treatment, compared to DMSO treatment. (C) Genes known to sensitize cellular response to PTX treatment. (D) Well-known resistant genes in response to PTX treatment. (E) Diagram illustrates construction of paclitaxel-resistant MDA-MB-231 cells. The cells were treated with 1 µM paclitaxel for 24 h, then changed to normal culture medium for 2 weeks. This procedure was repeated 12 times. (F) Bubble chart exhibiting significant differentially expressed genes with a log 2 -fold change (FC) ≤ -1 or ≥ 1. Bubble size represents the value of log 2 TPM in 231-PTX cells. (G) Triangle chart confirmed previously-reported genes playing a critical role in paclitaxel resistance in cancer. The size of the triangle represents the value of log 2 TPM in 231-PTX cells. (H) Distribution of the top 20 GSEA drug resistant-associated pathways: Taxol agent-related pathways constitute 25% of the total pathways. (I) One of the GSEA enrichment analyses among the top 20 Taxol-related pathways.

Article Snippet: The genome-wide CRISPR knockout (GeCKO v2) library was purchased from Addgene and was expanded to 1000× using an electronic transfection method.

Techniques: Genome Wide, CRISPR, Sequencing, Knock-Out

Paclitaxel-sensitive/resistant candidates and their clinical prognostic values in breast cancer. (A-B) Volcano plot displays gene distribution of paclitaxel-sensitive (A) paclitaxel-resistant (B) candidates. X-axis represents log 2 -fold change of 231-PTX versus 231-WT and Y-axis represents log 10 p value of CRISPR/Cas9-positive (A) / (B) -negative screening. (C-F) Kaplan-Meier analysis of paclitaxel-sensitive candidates. Relapse-free survival Kaplan-Meier plots were based on gene expression, and the auto-select best cut-off was used to sort patients ( p < 0.05). (G-J) Kaplan-Meier plot of paclitaxel-resistant candidates. Relapse-free survival Kaplan-Meier plots were based on gene expression, and the autos-elect best cut-off was used to sort patients ( p < 0.05). (K-L) Cell growth after individual gene knock-out with single guide (sg) RNA was evaluated following treatment with 1 nM paclitaxel or DMSO for 6 d (*: p < 0.05; **: p < 0.01).

Journal: Theranostics

Article Title: Truncated HDAC9 identified by integrated genome-wide screen as the key modulator for paclitaxel resistance in triple-negative breast cancer

doi: 10.7150/thno.44997

Figure Lengend Snippet: Paclitaxel-sensitive/resistant candidates and their clinical prognostic values in breast cancer. (A-B) Volcano plot displays gene distribution of paclitaxel-sensitive (A) paclitaxel-resistant (B) candidates. X-axis represents log 2 -fold change of 231-PTX versus 231-WT and Y-axis represents log 10 p value of CRISPR/Cas9-positive (A) / (B) -negative screening. (C-F) Kaplan-Meier analysis of paclitaxel-sensitive candidates. Relapse-free survival Kaplan-Meier plots were based on gene expression, and the auto-select best cut-off was used to sort patients ( p < 0.05). (G-J) Kaplan-Meier plot of paclitaxel-resistant candidates. Relapse-free survival Kaplan-Meier plots were based on gene expression, and the autos-elect best cut-off was used to sort patients ( p < 0.05). (K-L) Cell growth after individual gene knock-out with single guide (sg) RNA was evaluated following treatment with 1 nM paclitaxel or DMSO for 6 d (*: p < 0.05; **: p < 0.01).

Article Snippet: The genome-wide CRISPR knockout (GeCKO v2) library was purchased from Addgene and was expanded to 1000× using an electronic transfection method.

Techniques: CRISPR, Gene Expression, Knock-Out

a , Western blots of HEK293T cells and of Cx43 and Cx43/Cx45 knockout cell lines generated with CRISPR-Cas9. Vinculin was used as a loading control. b , Representative normalized fluorescence traces of two visually connected Cx43/Cx45 KO cells stably expressing rEstus2s. c , Linear correlation of the time traces from b with superimposed linear fit (bold line). d , r values from linear correlations of rEstus2s for Cx43 KO, Cx43/Cx45 KO, and Cx43/Cx45 KO with stable overexpression of Cx43. Black rhombs are means. e, f , Superimposed normalized fluorescence traces of 50 Cx43 KO cells each with rEstus2s, or Cx43/Cx45 KO cells with rEstus2s either alone or with additional overexpression of Cx43, ANO1, or K Ca 3.1. Cells were either individual (e) or in a confluent layer (f). g , Peak-to-peak excursions of relative rEstus2s fluorescence in individual and confluent cells. The number of analyzed cells is indicated in parentheses.

Journal: bioRxiv

Article Title: Sub-Millivolt Voltage Imaging Reveals Gap Junction-Mediated Bioelectric Contact Inhibition

doi: 10.64898/2026.02.10.701308

Figure Lengend Snippet: a , Western blots of HEK293T cells and of Cx43 and Cx43/Cx45 knockout cell lines generated with CRISPR-Cas9. Vinculin was used as a loading control. b , Representative normalized fluorescence traces of two visually connected Cx43/Cx45 KO cells stably expressing rEstus2s. c , Linear correlation of the time traces from b with superimposed linear fit (bold line). d , r values from linear correlations of rEstus2s for Cx43 KO, Cx43/Cx45 KO, and Cx43/Cx45 KO with stable overexpression of Cx43. Black rhombs are means. e, f , Superimposed normalized fluorescence traces of 50 Cx43 KO cells each with rEstus2s, or Cx43/Cx45 KO cells with rEstus2s either alone or with additional overexpression of Cx43, ANO1, or K Ca 3.1. Cells were either individual (e) or in a confluent layer (f). g , Peak-to-peak excursions of relative rEstus2s fluorescence in individual and confluent cells. The number of analyzed cells is indicated in parentheses.

Article Snippet: The following guide RNAs (gRNAs) from the human CRISPR knockout pooled library A (GeCKOv2) were cloned into the lentiCRISPRv2 (Addgene #52961): GJA1 (Cx43): 19135: TCAGCGCACCACTGGTCGCA, 19136: TGTGTTCTATGTGATGCGAA GJC1 (Cx45): 19177: CATCTTCCCGAATCCGTCGT, 19179: GCAAGCCCTATGCAATGCGC HEK293T cells were transiently transfected with the lentiCRISPRv2 expression plasmids using Roti®-fect.

Techniques: Western Blot, Knock-Out, Generated, CRISPR, Control, Fluorescence, Stable Transfection, Expressing, Over Expression